This will eventually be a game!! The artstyle gaps hurt me lol :') CURRENT TASK: Coding/drawing other cats & the camp Phase One is coding kits, starting cutscene, character selection, the nursery, the first Minigames, and the beginning tutorial. Phase Two will be more cats with dialogue and other activities while you're a kit. Phase Three will be apprentice ceremony cutscene and updated dialogue. Phase Four will be training, Phase Four-point-five will be gathering cutscenes and, if you're a med cat, the Moonstone or Moonpool or something. Phase Five will be becoming a full warrior or med cat, etc. Throughout those phases, there will also be options such as becoming a Kittypet, loner, or rouge. None are done yet. ---------------------------------------------------------------------------- Cat Generator DNA codes: Mom (Golden, Soft, Honey, Cream?): TTCCAATTAAATTTCCTCAAGGAGAACGAACCAGTGTTAGTGTTTTAA Dad (Stormtail): ACCAACAATTAATAAATTTCACAGTGAGAAGCAGATTGAGTGTTTATT Calico player choice/sibling: TAAAACATATATTTACTTATAATGTAAGAATAAGCCCCAGTGTTAAAA Tortie player choice/sibling: ATCCACATATATTTCCTCATTAAGAAATAAATAGCCCCAGTGTTAAAA Cream player choice/sibling: TCCCAATTATATTTACTCACGGAGAATGAAGGAGCCATAGTGTTAAAA Red & white player choice/sibling: ATCCACATATAATTACTCACACAGAATGAAATAGTGCGAGTGTTTTAA
If you have any kit name ideas, say what kit it's for and comment! It's always fun to add more! Erin Hunter for Warriors Me for art, code, etc. ---------------------------------------------------------------------------- INSPIRATION / SOURCES (I can't find all the links, but I'll keep trying to.) - https://scratch.mit.edu/projects/78985318/ (First Warriors game I ever played.) - https://scratch.mit.edu/projects/1014207337/ - https://scratch.mit.edu/projects/906825448/ (HUGE help! Wouldn't be possible without this!!) ---------------------------------------------------------------------------- People whose coding, art, etc. I actually used: @Kingdom_Animalia (Cat genetics thing! Helped SO MUCH! This wouldn't be possible without you!)